Assessment of bacteriocin production by clinical Pseudomonas aeruginosa isolates and their potential as therapeutic agents

Table 3 Primers sequnces in qRT-PCR

No.	Product lenght	Sequnces 5ʹ → 3ʹ	Primers
1	Pyocin S (NCBI Sequence ID: D12708.1)	Forward: AGCTGTAATGAGAGATGG	206 bp
1	Pyocin S (NCBI Sequence ID: D12708.1)	Reverse: CATTCGGAAATCTTGGAC	206 bp
2	16 s rRNA gene	Forward: TGGAGCATGTGGTTTAATTCGA	159 bp
2	16 s rRNA gene	Reverse: TGCGGGACTTAACCCAACA	159 bp

ISSN: 1475-2859